產(chǎn)品名稱 | Aspergillus niger van Tieghem |
---|---|
商品貨號 | B163486 |
Strain Designations | 4247 [AM 324, CBS 131.52, CBS 769.97, DSM 1957, IFO 6341, IMI 45551, J. Friedrich A98, KCC F-0086, NRRL 334, QM 324, QM 458, Steinberg, TC 215-4247, WB 334] |
Application | Assay of sulfur Degrades apple distillery waste Fungus resistance testing Fungus resistance testing adhesives Fungus resistance testing aircraft transmissions Fungus resistance testing automotive components Fungus resistance testing baking primer Fungus resistance testing carpets Fungus resistance testing lacquer Fungus resistance testing leather Fungus resistance testing packing materials Fungus resistance testing paint Fungus resistance testing paper and paperboard Fungus resistance testing plastics Fungus resistance testing sandbags Fungus resistance testing textiles Fungus resistance testing varnish Produces carboxymethyl cellulase CM-celluase Produces citric acid citrate Produces glucosidase, beta; acid Glucosidase; glucocerebrosidase Produces xylan endo-1,3-beta-xylosidase xylan hydrolase, xylanase Resistant to copper Sterility testing Testing Testing slimicide Degrades starch in wastewater Produces carboxymethyl cellulase, beta-glucosidase, and xylanase from oil palm wastes Produces extracellular lipases |
Biosafety Level | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
Product Format | freeze-dried |
Storage Conditions | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
Type Strain | no |
Preceptrol® | no |
Comments | Trace element nutrition studies Leaching of aluminum from red mud |
Medium | ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 28: Emmons' modification of Sabouraud's agar ATCC® Medium 200: YM agar or YM broth |
Growth Conditions | Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGAGTCCGCATTGTAATTTGCAGAGGATGCTTTGGGTGCGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGGTGTCCGTGCCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCTGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCAGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGAC Beta-tubulin (bTub) TTGCCCTCCCCGTCCCTCGTCCGTCAGGAGACGCGTCGTTGGTTGGCATCTCTTTTGCTCGGGACCCCACCGGTTCTTCGACCAACTCATTCTTGTGCTAACTGCATGTCTTCTTCGCTTCATAGGTTCACCTCCAAACCGGCCAGTGTGTAAGTGCCAATATATGCTTCGGATGATTGCCCCCAAGGGTCTTGATTGGTGTTTGGTGGACTAAACAATATATCATGGTGGTTAGGGTAACCAAATTGGTGCTGCTTTCTGGTACGTATACAACTGCCATTGGATTGGGGATGGAACATCGTCTCTTAGGCTATCTCAGCTTGAGTTCAGATGTTGTCCATTAGGTACATGCTATCGGTCTAAGAACACGTCTAACAATTCAACAGGCAGACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGTGTAAGTGCAACTTTTTCACACCTCTCAATTGGTCAACAATGGGCAAAGGGTTGGGTCTTCTGACACGCAGGATAGTTACAATGGCACCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGTGAGATCCATCGGACCTTGGCTTTTTCACGACAATATCATCAATGTCCTAATCACTTCAGCAGGCTAGCGGTAACAAGTATGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCTGGTAACAACTGG |
Name of Depositor | C Thom |
Chain of Custody | ATCC <-- C Thom <-- RA Steinberg |
Isolation | Leather |
Cross References | Nucleotide (GenBank) : GU256739 ITS including 5.8S rRNA gene Nucleotide (GenBank) : KU729128 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : KU897010 beta-tubulin (TUB2) gene |
References | Kikuchi K, et al. Method of producing carbon source for citric acid fermentation. US Patent 4,040,906 dated Aug 9 1977 Pabai F, et al. Interesterification of butter fat by partially purified extracellular lipases from Pseudomonas putida, Aspergillus niger and Rhizopus oryzae. World J. Microbiol. Biotechnol. 11: 669-677, 1995. Prasertsan P, Oi S. Production of cellulolytic enzymes from fungi and use in the saccharification of palm cake and palm fibre. World J. Microbiol. Biotechnol. 8: 536-538, 1992. Iwahori K, et al. Substrate permeability in pellets formed by Aspergillus niger. J. Ferment. Bioeng. 79: 387-390, 1995. Steinberg RA. Sulfur and trace-element nutrition of Aspergillus niger. J. Agric. Res. 63: 109-127, 1941. AATCC Antifungal Activity, Assessment on Textile Materials: Mildew and Rot Resistance of Textile Materials. Research Triangle Park, NC:American Association of Textile Chemists and Colorists;AATCC Test Method 30-2004. AATCC Antimicrobial Activity Assessment of Carpets. Research Triangle Park, NC:American Association of Textile Chemists and Colorists;AATCC Test Method 174-1998. ASTM International Standard Test Method for Resistance to Growth of Mold on the Surface of Interior Coatings in an Environmental Chamber. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 3273-00 (Reapproved 2005). Deutsches Institut fur Normung Testing of plastics: Influence of fungi and bacteria; visual evaluation, change in mass or physical properties. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 53739. IEC Basic environmental testing procedures: Mould growth. Geneva (Switzerland):International Electrotechnical Commission;IEC 60068-2-10, Part 2, Test J. U.S. Department of Defense Environmental test methods and engineering guidelines. Washington, DC:US Department of Defense;Military Standard MIL-STD-810F, 2000 Leather, methods of sampling and testing. Washington, DC:US General Services Administration;Fed. Test Method Std. 311, 1962 Machemer WE. Use of mercury in protective coatings. Dev. Ind. Microbiol. 20: 25-39, 1979. Katta MI, Lynd JQ. Sulfur bioassay investigations with Aspergillus niger. Bot. Gaz. 126: 120-123, 1965. Sandvik O. Identification of moulds by serologic differentiation of their proteolytic enzymes. Acta Pathol. Microbiol. Scand. Sect. B Microbiol. 71: 333-338, 1967. Friedrich J, et al. The use of Aspergillus niger for bioconversion of apple distillery waste. Eur. J. Appl. Microbiol. Biotechnol. 17: 243-247, 1983. Bowman FW, et al. Collaborative study of aerobic media for sterility testing by membrane filtration. J. Pharm. Sci. 60: 1087-1088, 1971. PubMed: 5000479 Fujita M, et al. Pellet formation of fungi and its application to starch wastewater treatment. Water Sci. Technol. 28: 267-274, 1993. Vachon P, et al. Chemical and biological leaching of aluminum from red mud. Environ. Sci. Technol. 28: 26-30, 1994. Standard Test Method for Efficacy of Slimicides for the Paper Industry-Bacterial and Fungal Slime. West Conshohocken, PA:ASTM International;ASTM Standard Test Method E 1839-07. Environmental testing. Part 2.10: Tests--Test J and guidance: Mould growth. Sydney, NSW, Australia:Standards Australia;Standards Australia AS 60068.2.10-2003. Fibre Optic interconnecting divices and passive components --Basic test and measurement procedures--Part 2-16: Tests --Mould growth. Geneva (Switzerland):International Electrotechnical Commission;IEC 1300-2-16, 1995 Plastics--Evaluation of the action of micro-organisms. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 846:1997. Plastics--Assessment of the effectiveness of fungistatic compounds in plastics formulations. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 16869:2001. Testing of textiles -- Evaluation of the action of microfungi. London, UK:British Standards Institution;British Standard BS EN 14119:2003, 2003 Standard Specification for Poly(Vinyl Chloride) (PVC) Plastic Flexible Concealed Water-Containment Membrane. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4551-96 (Reapproved 2001). Standard Specification for Retroreflective Sheeting for Traffic Control . West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4956-07e1. Standard Test Method for Determining the Resistance of Paint Films and Related Coating to Fungal Defacement by accelerated Four-Week Agar Plate Assay. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 5590-00 (Reapproved 2005). Standard method of evaluating the resistance of wood product surfaces to mold growth. Birmingham, AL: American Wood-Preservers' Association; AWPA E24-06, 2006 Plastics - Evaluation of the action of microorganisms. London, UK:British Standards Institution;British Standard BS EN ISO 846:1997. Paper and board intended to come into contact with foodstuffs --- Determination of the transfer of antimicrobial constituents. London, UK:British Standards Institution;British Standard BS EN 1104:2005. Lawrence DP, et al. Interkingdom gene transfer of a hybrid NPS/PKS from bacteria to filamentous Ascomycota. PLoS One 6: e28231, 2011. PubMed: 22140558 Geiser DM, et al. The current status of species recognition and identification in Aspergillus. Stud Mycol 59: 1-10, 2007. PubMed: 18490947 Liu YJ, Hodson MC, Hall BD. Loss of the flagellum happened only once in the fungal lineage: phylogenetic structure of kingdom Fungi inferred from RNA polymerase II subunit genes BMC Evol Biol 6: 74, 2006. PubMed: 17010206 |
梅經(jīng)理 | 17280875617 | 1438578920 |
胡經(jīng)理 | 13345964880 | 2438244627 |
周經(jīng)理 | 17757487661 | 1296385441 |
于經(jīng)理 | 18067160830 | 2088210172 |
沈經(jīng)理 | 19548299266 | 2662369050 |
李經(jīng)理 | 13626845108 | 972239479 |